Journal: Molecular & Cellular Proteomics : MCP

Article Title: Identification of Novel Natural Substrates of Fibroblast Activation Protein-alpha by Differential Degradomics and Proteomics *

doi: 10.1074/mcp.RA118.001046

Figure Lengend Snippet: In vitro examination of candidate substrate CSF-1. A, CSF-1 primary antibody paired with a secondary anti-goat Alexa Fluor 647 stained the N terminus of CSF-1 in the FAP e+ and e− MEFs after permeabilization with 0.05% (w/v) saponin. 23.7% of FAP e− MEFs were immunopositive compared with only 4.5% of the FAP e+ MEFs. Goat IgG was used as a negative control. B, Immunoblotting of CSF-1 in whole cell lysates revealed more cellular CSF-1 present in FAP e− MEFs than FAP e+ MEFs. Densitometry was performed using GAPDH as a loading control. (A, B) Representative of two independent experiments. C, Schematic of the primary structure of CSF-1. The Uniprot-annotated N terminus sequence is shown with the proposed FAP cleavage site indicated by a red arrow after Pro449. This cleavage site identified in TAILS is in the extracellular region, near the transmembrane domain. Identified peptide from TAILS analysis and its corresponding fold change are shown. Synthetic recombinant peptide consists of Ser442 to Arg463, with the proposed FAP cleavage site indicated by a red arrow. D, MALDI-TOF-MS showing no cleavage of the synthetic recombinant CSF-1 peptide after 16 h incubation with rhFAP at 37 °C.

Article Snippet: Primary antibodies were a goat polyclonal to mouse CSF-1 (AF416; R&D Systems) at 0.2 μg/ml and a rabbit polyclonal to LOX-L1 at 0.3 μg/ml (NBP1–82827; Novus Biologicals, Littleton, CO).

Techniques: In Vitro, Staining, Negative Control, Western Blot, Sequencing, Recombinant, Incubation

Journal: Cell reports

Article Title: Microglia are Indispensable for Synaptic Plasticity in the Spinal Dorsal Horn and Chronic Pain

doi: 10.1016/j.celrep.2019.05.087

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-ATF3 Santa Cruz Biotechnology Cat# sc-188 RRID:AB_2258513 Goat anti-Iba1 Abcam Cat# ab5076 RRID:AB_2224402 Rat anti-NIMP-R14 Santa Cruz Biotechnology Cat# sc-59338 RRID: AB_2167795 Goat anti-CGRP Abcam Cat# 36001 RRID: AB_725807 Mouse anti-CGRP Abcam Cat# ab81887 RRID: AB_1658411 Isolectin B4-FITC Sigma Cat# L2895 Rabbit anti-Synaptophysin Abcam Cat# ab16659 RRID: AB_443419 Rabbit anti-GAP43 Abcam Cat# ab128005 RRID:AB_11141048 Rabbit anti-Substance P receptor EMD Millipore Cat# AB5060 RRID:AB_2200636 Goat anti-CSF1 R&D Systems Cat# AF416 RRID:AB_355351 Goat IgG R&D Systerms Cat# AB-108-C RRID:AB_ Rabbit anti-CSF1R Santa Cruz Biotechnology Cat# sc-692 RRID:AB_631025 Rat anti-CD11b Biolegend Cat# 101202 RRID:AB_312785 Rabbit anti-BDNF Millipore Cat# AB1534 RRID:AB_90746 Rabbit anti- phospho-p38 Cell Signaling Technology Cat# 4511 RRID:AB_2139682 Mouse anti-β-actin Cell Signaling Technology Cat# 3700 RRID:AB_2242334 Chemicals, Peptides, and Recombinant Proteins D-AP5 Tocris Cat# 0106 Lidocaine Sigma Cat# L7757 Collagenase Sigma Cat# C9891 Trypsin Sigma Cat# T9201 Poly-L-Lysine Sigma Cat# P4832 Glutamine Sigma Cat# G7513 ANA-12 Tocris Cat# 4781 666-15 Tocris Cat# 5661 SB203580 Tocris Cat# 1202 CSF1 Biolegend Cat# 576402 BDNF R&D Systems Cat# 248-BD Tamoxifen Sigma Cat# T5648 Diphtheria toxin Sigma Cat# C8286 Urethane Sigma Cat# U2500 Lidocaine Sigma Cat# L7757 Fluoromount-G Southern Biotech Cat# 0100-01 Experimental Models: Organisms/Strains C57BL/6J Jackson Laboratories Cat# JAX:000664 RRID:IMSR_JAX:000664 CX3CR1 CreER/+ mice Parkhurst et al., 2013 Cat# JAX:021160, RRID:IMSR_JAX:021160 BDNF flox/flox (BDNF TM3JAE /J) Jackson Laboratories Cat# JAX:004339, RRID:IMSR_JAX:004339 R26 iDTR/+ mice Jackson Laboratories Cat# JAX:007900, RRID:IMSR_JAX:007900 Sprague–Dawley rats Charles River Laboratory Cat# 10395233, RRID:RGD_10395233 Oligonucleotides Csf1 Forward: GTGTCAGAACACTGTAGCCAC Thermo Fisher Scientific N/A Csf1 Reverse: TCAAAGGCAATCTGGCATGAAG Thermo Fisher Scientific N/A β-actin Forward: CCACACCCGCCACCAGTTCG Thermo Fisher Scientific N/A β-actin Reverse: TACAGCCCGGGGAGCATCGT Thermo Fisher Scientific N/A Software and Algorithms ImageJ National Inst.

Techniques: Recombinant, Software, Microscopy

Journal: Scientific Reports

Article Title: Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs

doi: 10.1038/s41598-020-70302-9

Figure Lengend Snippet: Immunohistochemistry of GM-CSF in pig testes. Positive immunolabelling is seen in ( a ) the interstitium (Leydig cells) and the residual bodies of elongated spermatids. ( b ) Detail of positivity in residual cytoplasm derived from spermatids (arrows). ( c ) Expression in cytoplasmic droplets attached to neck region of immature spermatozoa (arrow). ( d ) Strong cytoplasmic immunostaining in Leydig cells (arrows) and weak in Sertoli cells (arrowhead). Scale bars: ( a ) 100 μm; ( b and c ) 20 μm; and ( d ) 50 μm.

Article Snippet: The smears were then blocked with PBS-Glycine 0.02 M at RT for 20 min, washed (2 times in PBS for 5 min) and incubated with the primary antibody against GM-CSF [1:200 in PBS 0.1% BSA (v/w); GM-CSF polyclonal rabbit orb6090, Biorbyt, St. Francisco, CA, USA] at 4 °C, overnight.

Techniques: Immunohistochemistry, Derivative Assay, Expressing, Immunostaining

Journal: Scientific Reports

Article Title: Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs

doi: 10.1038/s41598-020-70302-9

Figure Lengend Snippet: Immunohistochemistry of GM-CSF in pig epididymis. Immunoreactivity in ( a ) supranuclear region of the principal cells (arrow) of the epithelium from the caput segment. Arrowheads identifies apically-stained cells, and intralumenal vesicles positive ( b ) to GM-CSF (the relative size of the arrows used illustrate differences in vesicle size and arrowheads mark apical protuberances of principal cells). Insert: gross arrow: positive vesicle; narrow arrows: smaller positive vesicles inside the vesicles. Scale bars: ( a ) 50 μm; and ( b detail) 20 μm .

Article Snippet: The smears were then blocked with PBS-Glycine 0.02 M at RT for 20 min, washed (2 times in PBS for 5 min) and incubated with the primary antibody against GM-CSF [1:200 in PBS 0.1% BSA (v/w); GM-CSF polyclonal rabbit orb6090, Biorbyt, St. Francisco, CA, USA] at 4 °C, overnight.

Techniques: Immunohistochemistry, Staining

Journal: Scientific Reports

Article Title: Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs

doi: 10.1038/s41598-020-70302-9

Figure Lengend Snippet: Immunohistochemistry of GM-CSF in pig accessory sex glands. Immunolabelling in ( a ) prostate, present in supranuclear cytoplasm and small vesicles (arrow) in the lumen; ( b ) corpora amylacea (arrow); ( c ) vesicles in lumen (asterisk); ( d – f ) Seminal vesicle with staining in protruding apical membranes (arrows) and ( g ) the bulbourethral gland where immunostaining was observed in vascular smooth muscle, but not in secretory epithelium (asterisk). Scale bars: ( a ) 20 μm; and ( b – g ) 50 μm.

Article Snippet: The smears were then blocked with PBS-Glycine 0.02 M at RT for 20 min, washed (2 times in PBS for 5 min) and incubated with the primary antibody against GM-CSF [1:200 in PBS 0.1% BSA (v/w); GM-CSF polyclonal rabbit orb6090, Biorbyt, St. Francisco, CA, USA] at 4 °C, overnight.

Techniques: Immunohistochemistry, Staining, Immunostaining

Journal: Scientific Reports

Article Title: Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs

doi: 10.1038/s41598-020-70302-9

Figure Lengend Snippet: Immunocytochemistry of GM-CSF in the pig mature spermatozoa. Top images ( a and c ) show spermatozoa with low/absent GM-CSF expression and bottom images show spermatozoa viable and non-viable (DAPI stain). The sperm samples were incubated with anti-GM-CSF antibody (orb6090, Biorbyt) to identify GM-CSF expression (composite in red in top images) and incubated with DAPI staining to identify viable from non-viable (DAPI positive in blue in bottom images) spermatozoa. Sperm in ( a ) and ( c ), were included in cluster 1 (fluorescence intensity 4.45 ± 0.17 RU; ranging from 0.0 to 15.33 RU) while spermatozoa displaying high GM-CSF expression were included in cluster 2 (fluorescence intensity 29.81 ± 1.82 RU; ranging from 15.67 to 84.0 RU, b and d ). Scale bar: 10 μm. Cropped image of immunocytochemistry capture (see Supplemental Information, Fig for full image).

Article Snippet: The smears were then blocked with PBS-Glycine 0.02 M at RT for 20 min, washed (2 times in PBS for 5 min) and incubated with the primary antibody against GM-CSF [1:200 in PBS 0.1% BSA (v/w); GM-CSF polyclonal rabbit orb6090, Biorbyt, St. Francisco, CA, USA] at 4 °C, overnight.

Techniques: Immunocytochemistry, Expressing, Staining, Incubation, Fluorescence

Journal: Scientific Reports

Article Title: Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs

doi: 10.1038/s41598-020-70302-9

Figure Lengend Snippet: Proportion of spermatozoa hierarchically clustered in two populations according to the expression of GM-CSF in the viable and nonviable sperm population. a,b Indicate significant differences ( p < 0.01) between cluster 1 and 2. The cluster 1 gathered the spermatozoa showing low/absent fluorescence intensity (4.45 ± 0.17 RU; ranging from 0.0 to 15.33 RU) corresponding with a low/absent GM-CSF expression. The cluster 2 gathered those sperm displaying high fluorescence intensities (29.81 ± 1.82 RU; ranging from 15.67 to 84.0 RU).

Article Snippet: The smears were then blocked with PBS-Glycine 0.02 M at RT for 20 min, washed (2 times in PBS for 5 min) and incubated with the primary antibody against GM-CSF [1:200 in PBS 0.1% BSA (v/w); GM-CSF polyclonal rabbit orb6090, Biorbyt, St. Francisco, CA, USA] at 4 °C, overnight.

Techniques: Expressing, Fluorescence

Journal: Scientific Reports

Article Title: Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs

doi: 10.1038/s41598-020-70302-9

Figure Lengend Snippet: Western blot analysis and relative quantification of GM-CSF expression in porcine genital tract, epididymal fluid (EF), seminal plasma (SP) and in spermatozoa from cauda epididymis (CE) and different ejaculate portions. In ( a1 ), three bands of GM-CSF expression with the different glycosylation degrees: 15, 31 and 40 kDa. In ( a2 – a4 ), the relative quantity of 15 kDa ( a2 ), 31 kDa ( a3 ) and 40 kDa ( a4 ) in reproductive tissues; T: testes. CaE: caput epididymis. CoE: corpus epididymis. CauE: cauda epididymis. P: prostate. SV: seminal vesicle. B: bulbourethral gland. In (b1 ) one band of active GM-CSF expression of 15 kDa. In ( b2 ) relative quantity of 15 kDa in EF and SP from the different ejaculate portions: first 10 mL-SRF, rest of SRF, post-SRF, entire ejaculate (EE). ( c1 ) Two bands of active and glycosylated GM-CSF of 15 and 31 kDa. ( c2 and c3 ) Relative quantity of 15 kDa ( c2 ) and 31 kDa ( c3 ) in mature spermatozoa from CE, first 10 mL-SRF, rest of SRF, post-SRF and EE. L: expression in liver tissue, as control. a–d Indicate relative quantitative differences ( p < 0.05) among tissues, fluid and sperm sources. SRF: sperm-rich fraction. Cropped image of Western blot (see Supplemental Information, Fig for full image).

Article Snippet: The smears were then blocked with PBS-Glycine 0.02 M at RT for 20 min, washed (2 times in PBS for 5 min) and incubated with the primary antibody against GM-CSF [1:200 in PBS 0.1% BSA (v/w); GM-CSF polyclonal rabbit orb6090, Biorbyt, St. Francisco, CA, USA] at 4 °C, overnight.

Techniques: Western Blot, Quantitative Proteomics, Expressing, Clinical Proteomics, Glycoproteomics, Control